alinab575 alinab575
  • 02-02-2020
  • English
contestada

What are some examples of figurative language in everyday life?

Respuesta :

ali1243daniya
ali1243daniya ali1243daniya
  • 02-02-2020
•Metaphor.
• Simile.
• Hyperbole.
• Idiom.
• Synecdoche.
• Personification.
• Allusion.
• Oxymoron.
Actual examples:
1. The world is my oyster.
2. You're a couch potato.
3. Time is money.
4. He has a heart of stone.
5. America is a melting pot.
6. You are my sunshine.
Answer Link
greg3113
greg3113 greg3113
  • 02-02-2020
i’m so hungry i could get a whole horse
Answer Link

Otras preguntas

Which three minerals are most likely used in the construction of a house?
how does land pollution effect our water
1. Generalmente, ¿a qué hora te despiertas durante la semana?
(7.11 x 10') (2.97 x 10-3)​
Convert 4 oz into pounds
What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT
Which North African nation exports more oil than all but 15 other countries in the world?
4. Which of the following expressions shows how to use the quadratic formula to solve 2x2-3x - 80? А -3 ± √(-3)² - 4(2)(-8) 2(2) 30 (-3)? - 4(2)(-8) B 2(2) -33-
Use the Law of Sines to find mZY. Round to the nearest degree. X 14 m 30 m 123° Z
I’m not good with these somebody please help me