catzilla3096 catzilla3096
  • 03-09-2020
  • Mathematics
contestada


Which of the following represents the area of a rectangle whose length is x - 7 and whose width is x + 12?

Respuesta :

BrainlyWarrior
BrainlyWarrior BrainlyWarrior
  • 03-09-2020

Answer :

Length of rectangle = x - 7

Width of rectangle = x + 12

We have to find area of rectangle[tex].[/tex]

_________________________________

[tex]:\implies\sf\:Area=Length\times Width[/tex]

[tex]:\implies\sf\:Area=(x-7)(x+12)[/tex]

[tex]:\implies\sf\:Area=x^2+12x-7x-84[/tex]

[tex]:\implies\bf\:Area=x^2+5x-84[/tex]

Answer Link

Otras preguntas

Which of these is a mixture? A. Carbon Dioxide B. salt water C. calcium D. potassium
Tennis is classified as an exercise program true or false
Point A is located at (4, 1) point B is located at (9, 13) What are the coordinates of the point that partitions the directed line segment AB in a 4:1 ratio
Simplify. 3^2 · 3^4 · 3^6 A) 30 B) 310 C) 312 D) 348
what is the Haitian revolution?
PLEASE HELP!!!!!!!!!!!!!!!!!!! Enzo and Beatriz are playing games at their local arcade. Incredibly, Enzo wins 5 tickets from every game, and Beatriz wins 11 ti
Check all that apply. Claims must always be supported by evidence such as facts. opinions. statistics. quotations. examples. hypotheticals.
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
what type of tax system does the United States have
Indicate whether the sentence or statement is true or false. American Indian cultures had no written language until the early 1800s.