hawoabdi585 hawoabdi585
  • 12-09-2020
  • Mathematics
contestada

K is the midpoint of J and L, then find x.
Given: JK = 5x - 3
KL = 3x + 1

Respuesta :

Estellia
Estellia Estellia
  • 12-09-2020

Answer:

[tex]x=2[/tex]

Step-by-step explanation:

K is the midpoint of J and L, so

JK = KL.

[tex]5x-3=3x+1[/tex]

Add 3 to both sides:

[tex]5x-3+3=3x+1+3[/tex]

[tex]5x=3x+4[/tex]

Subtract 3x from both sides:

[tex]5x-3x=3x+4-3x[/tex]

[tex]2x=4[/tex]

Divide 2 on both sides:

[tex]\frac{2x}{2}=\frac{4}{2}[/tex]

[tex]x=2[/tex]

Answer Link

Otras preguntas

John weighs 1.5 times as much as Ellen. If John weighs 144 pounds how much does Ellen weigh?
Create a dictionary password cracker or a brute force
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
Help asap pleaseee! A climber is on a hike. After 2 hours, he is at an altitude of 400 feet. After 6 hours, he is at an altitude of 700 feet. What is the averag
math question down below
A triangle has sides of length 10 m, 15 m, and 8m. Is it a right triangle?
Describe how C. parvum obtains the glucose it needs for glycolysis after it has infected another cell. Explain the role of lactate dehydrogenase in enabling C.
Select all of the integers less than -31: -122: 03: -44: 35: -10​
When the Sun’s radiant energy falls on Earth’s oceans, it causes water to change state by evaporating. Which form of energy does water vapor have?
Determine whether or not each figure is a parallelogram. WILL MARK BRAINLIEST