rochellem rochellem

11-10-2016
Geography

contestada

how much government revenue has africa devoted to interest payments

Respuesta :

KittyKatter KittyKatter

11-10-2016

The answer is one-third

Answer Link

rockinhood rockinhood

12-10-2016

One-third is correct.

Answer Link

Otras preguntas

Which of the following represents how neurologists would refer to the "third" cranial nerve? Question 15 options: C 3 tertiary III WILL MARK YOU BRANILIEST!!!!

3 Circle the addition related fact that can be used to solve the subtraction number sentence. 10-4-6 4+2=6 2+4=7 7-0=0 674-10

-2 What is the Domain: What is the Range:

in the parking lot , all of the lines for the parking spaces should be parallel. If m<3 = 61, what should m<1 and m<1 be

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Find the area of the figure. (Sides meet at right angles.) 1 5 yd 4 yd 4 yd 5 yd 4 yd 4 yd 5 yd

Jimmy rolls a number cube multiple times and records the data in the table above. At the end of the experiment, he counts that he has rolled 185 fours. Find the

Help pls ASAP 1a. When a lot of people are swimming in a pool, the water become cloudy. Explain why? b. The water in an empty pool is very clear. is it still a

According to stoke what commonly held value explain many of the trends in U.S attitude toward social safety net

PLEASE ANSWER ASAP: Caleb is investigating the effect of friction on the motion of an object. He uses the following supplies for the investigation: 1. A wooden