104170angel 104170angel

11-12-2022
Biology

contestada

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated DNA strand) GTAGTAGTAGGAGTAGTAGTA. What type of mutation is illustrated? A insertion B Translocation C Substitution D Deletion

Respuesta :

Otras preguntas

How did the first people to migrate to North America reach it

Ill give brainliest and 30 points someone give me your honest opinion on this

Choose the estimate closest to the length of a woman's hand : 30 cm, 200mm, or 20 mm. Which is the correct answer?

which word describes a statement that has been accepted, tested, and supported by multiple sets of evidence? theory theory hypothesis hypothesis procedure proce

why do we harmed each other?

need the domain and range!

Solve the inequality and express your answer in interval notation. x^2-12x+5<0

Write your answer in the space provided before the number. 1. If you study hard, you might pass the exit exam. 2. Don't leave your window open at night. Someone

4|2x + 5|-7≤9 How would you solve this?

An electrician charges $24 per hour and $36 for each hour of overtime. For a job, the electrician works 8 regular hours and overtime hours. He also charges $202