sharidler sharidler
  • 15-12-2022
  • Biology
contestada

original DNA: TACTTTAATCCCAAATTTACT

DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?​

Respuesta :

Otras preguntas

The principal broker is charged with keeping records of completed transactions for a period of______years.
Describe the features of the pyramid
Lionel works in the corporate office of a chain of organic supermarkets. The company’s marketing makes clear that one of its core principles is ""building better
The term Orwellian refers to concepts or phrases from Orwell's writing that have entered our language. " All Animals Are Equal But Some Animals Are More Equal T
Why were books by black authors not taught in Mississippi schools?
Who backed the first colonization efforts undertaken by the English in the New World?
perfect cube.[tex]7.4[/tex]​
What are type of protected speech
In a(n) ______ form of democracy (for example, the type that might be conducted through town meetings) citizens decide policy instead of depending on elected re
Choose the correct form of servir to complete the sentence. El Sr. García _______ las hamburguesas primero. a.sirvo b. sirve c. sirves d. sirven