cristianxdxdzd5059 cristianxdxdzd5059
  • 11-01-2024
  • Law
contestada

Under the MPC insanity test, a defendant may raise the defense of insanity where ______.

A) Intention is proven
B) Mental disease or defect exists
C) Voluntary intoxication occurs
D) Duress is present

Respuesta :

Otras preguntas

Please help me out if you want brainliest !!!!! ASAP easy
A researcher is investigating the of effects a chemical that makes thylakoid membranes permeable to hydrogen ions (H+). Which of the following is most likely di
Which of the following is NOT true about cluster sampling? A. B. C. D.
i want nothing more than for this to happen
heyyy can someone pleasee use the diagram to answer the true/false question xx
What are the voting rights of the citizens in Saudi Arabia
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTA
which devices are used in networking
A 4 kg cart has a momentum of 12 kg•m/s. What is the cart's velocity?
7(1 - x) = -3(x - 2) What is x please help me