Kayleeann144
Kayleeann144 Kayleeann144
  • 02-12-2015
  • Mathematics
contestada

0.55 as fraction
in simplest form

Respuesta :

ImpatientAngel
ImpatientAngel ImpatientAngel
  • 02-12-2015
0,55 = [tex] \frac{55}{100} [/tex]

[tex] \frac{55}{100} = \frac{11}{20} [/tex]

Nice days..........
Answer Link

Otras preguntas

What are the Pros and Cons of the song dynasty?
Why should percy jackson leave camp half blood?
Which is 23/5 expressed as a whole or mixed number?
In the novel the old man and the sea the old man struggled with a marlin. true false
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
What is the sum of -2 and -7?
At least 20 to 30 minutes of sunlight exposure 3 times per week should provide enough vitamin user: which key nutrient has been known to reduce the risk of hear
A water tank has 22 gallons of water. It begins to receive 26 gallons per hour for a number of hours. If the tank needs to fill to at least 516 gallons, which o
Sarah uses some passive reading habits. choose the change she should make to become a more active reader.
sum of 8/10 plus 17/100 equals