luckyaskker3387 luckyaskker3387
  • 14-05-2018
  • Biology
contestada

Irreversible nerve damage can be caused by a deficiency of the vitamin _____ or an excess of the vitamin ______

Respuesta :

princessalane
princessalane princessalane
  • 15-05-2018
Irreversible nerve damage can be caused by a deficiency of the vitamin B-12 or an excess of the vitamin B-6.
Answer Link

Otras preguntas

Appendicular Muscles - A&P - muscles and decide whether this muscle is the prime mover
consider the polynomial function p(x) = -5x^6-3x^5+4x^2+6x What is the end behavior of the graph of p?
Plz i need this done quick thx
What congruence theorem can you use to show that the two wedges of cheese have the same length? 9.6 cm 9.6 cm 3.2 cm 3.2 cm You can show that the two wedges of
sound waves have a frequency of 1000 hz what is their period?​
Why is cultural competency important?​
I need help with this problem, I’m not really sure how to solve it.. :(
what are image of 5/2 slope​
You own 3/5 of the coins in a collection. What percent of the coins do you own? Enter the percent with the percent sign
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU