mlemm8492 mlemm8492
  • 14-05-2018
  • History
contestada

How was the spanish-american war a significant point in america's emergence as a world power?

Respuesta :

AbbeySalomon
AbbeySalomon AbbeySalomon
  • 14-05-2018
The Americans won the Spanish-American War. As a result of the Treaty of Paris, the US gained territory in the Pacific and Carribean, including Guam, Puerto Rico, and the Philippines. This led to the US increasing production of more foreign goods that they could now produce in their own territories, and therefore expanded their markets.
Answer Link

Otras preguntas

do chemical equations with no reaction still have to be balanced
The cost of a concert ticket last week was $60.00. This week a concert ticket is $75.00. What is the percent increase of the ticket from last week to this week
A water pitcher contains 2/3 gallons of water you add 5/7 gallons of water to the picture how much water to the picture contain right the answer in simplest for
Helpppppp I’ll mark brainliest
What are the logical target organs for cancer related to coal mining? Can you think of other organs that may be affected by the coal dust?
(NO SAMPLE RESPONSES!) Explain how the number devil helps the author convince readers that mathematics is fun.
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
EUROPE 1200-1450: • Describe the politically fragmented and decentralized monarchies, feudal system and manorial system. • What was the effect of technology on
witch one is it A or B
PLS HELP !!! have a good day B)