elladowns7815 elladowns7815

03-06-2018
History

contestada

The anti-black, anti-catholic, and anti-semitic organization that claimed over 3 million members by the mid-1920s was:

Respuesta :

19mwiggins 19mwiggins

07-06-2018

the Ku Klux Klan (KKK) gathered huge support in the mid 1920s but quickly died off after that. they still exist today, but are a small group.

Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Annie's parents have offered her two different allowance options for her 10 week summer vacationAnnie's mom offers Annie an allowance where she gets paid 25 the

in the diagram,the measure of angle ACB is 25 degrees. what is the measure of angle AOB?

Stars fuse most of the hydrogen in the entire star before they die. 2 poir True False

What is the first step to solve this equation 9=2x+5

Set the Room temp. to -10.0 °C and observe. What is happening? plzzz i need help on the ASAP no files/links

Scientists use characteristics to compare stars. Match each characteristic on the left with the statement on the right that uses it to compare stars.

When was the last time you tried doing something new? What's the next risk you will take to improve your life?

13 A company studied the number of lost time acedents occurring at its Brownsville, Texas, plant. Historical records show that 0% of the employees suffered lost

question 8 thank youuu