Seudónimo Seudónimo
  • 04-08-2018
  • Mathematics
contestada

Geometry math question

Geometry math question class=

Respuesta :

gmany
gmany gmany
  • 07-08-2018

Look at the picture.

[tex]\alpha=360^o-200^o=160^o[/tex]

Answer: [tex]A.\ R_{160^o}[/tex]

Ver imagen gmany
Answer Link

Otras preguntas

the five degree measures for five angles are 30, 40, 35, 50, and 55 degrees. find the median angle measure. change it to radians. round your answer to the neare
The description below belongs to which of the following characters? physically unattractive, introverted, kindly, A. Silas Marner B. Nancy Lammeter C. Godf
A burning splint will burn more vigorously in pure oxygen than in air because ________. a burning splint will burn more vigorously in pure oxygen than in air be
A cube has width of 8 cm. What is the volume of the cube!?
What are some advantages of breeding strategies
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
In high school, Daphne excelled in English, earning mostly A’s on her papers. She had a knack for figuring out what teachers wanted to read and knew how to deli
How did the nazis create a public image of hitler that won the support of so many Germans?
What was the first living cells to evolve on earth?
When 3-year-old aaron takes his sister's doll away, she begins to cry. after being scolded by his father, aaron insists that he didn't do anything to make his s