alibeast2010 alibeast2010

13-10-2018
History

contestada

Which piece of legislation kept the balance between free states and slave states?

A.The Wilmot Proviso

B.The Fugitive Slave Act

C.The Compromise of 1850

D.Popular sovereignty

Respuesta :

GEazy13 GEazy13

13-10-2018

the compromise of 1850

Answer Link

Otras preguntas

Robert wrote a check to pay for his groceries. He thought he had $250 in his checking account but he actually had $200. Determine the percent of error

A cyclist coasts up a 9.00° slope, traveling 12.0 m along the road to the top of the hill. If the cyclist’s initial speed is 9.00 m/s, what is the ﬁnal speed? I

On January 1, 20X4, Polar Corp. paid $104,000 for $100,000 par value, 9% bonds of Seal Corp. Seal had issued $300,000 of the 10-year bonds on January 1, 20X2 fo

Enid has £300 in his saving account his bank offers him a fixed 5% simply interest rate per annum for a period of three years how much interest will he have and

Choose the multiple choice answers which, when strung together, create an accurate definition of GDP. The U.S. nominal gross domestic product is all final goods

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

The area of a rectangular room is 750 square feet. The width of the room is 5 feet less than the length of the room. Which equations can be used to solve for y,

Which of the following statements is not an accurate description of a factor that contributes to the ordering of the spectrochemical series for ligands and meta

Which of the following are the solutions to quadratic equation x 2 − 8 x + 12 = 0? Group of answer choices x=6 or 2 x = -6 or -2 x= 8 or -12 x= 4 or -2

Robert wrote a check to pay for his groceries. He thought he had $250 in his checking account but he actually had $200. Determine the percent of error