aurianarawls aurianarawls
  • 02-11-2018
  • English
contestada

A(n) _____ meaning refers to the literal definition of a word.

Respuesta :

tarhunbalthazar
tarhunbalthazar tarhunbalthazar
  • 02-11-2018

A denotation meaning refers to the literal definition of a word. It is the dictionary definition of a word.

Answer Link
Аноним Аноним
  • 02-11-2018

Denotative. Connotative is more like the "feeling" that goes with typical use of the word, like whether it's typically a good or a bad thing.


Answer Link

Otras preguntas

define these terms about speed and state their units speed​distance coveredtime taken
Put these in order starting from the smallest 5^2 2^4 3^3 1^8
report about Reduce, Reuse, Recycle and example
Bro I put this as a free answer, What is the best flavor of doritos?
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
The dimensions for a rectangular prism are x + 7 for the length, x + 9 for the width, and x for the height. What is the volume of the prism? Enter your answer a
s = 2b + ph solve for h
2 1/2 + 3 5/8 Add the fractions
Two students used different methods to measure the length of their model bridgeproject. One student measured the bridge length in feet using 11n−2.9. The second
what drawing technique is used in the art piece below?​