arrowqueenflash arrowqueenflash

14-11-2018
Biology

contestada

compare and contrast the difference between the Rocky planets and the gas giants

Respuesta :

bowermancollee bowermancollee

14-11-2018

Rocky planets are closer to the sun, hotter, and smaller. The gas giants are larger and colder.

Answer Link

Otras preguntas

what would have caused Norsemen to turn from trade to savage plundering?

xcerpt from Hard Times Charles Dickens The scene was a plain, bare, monotonous vault of a school-room, and the speaker's square forefinger emphasized his obser

Reactions that break apart large molecules are involved in which type of digestion?

four contributory factors that need to be considered when conducting impact studies

What kind of carbohydrate is a sugar? What kind is a starch?

When is each branch (Legislative, Executive, Judicial) most powerful? What situation would they be most powerful in?

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

What is the appropriate personal pronoun for the bold word in the following sentence? Gina wrapped the gift in blue paper.

Pentaborane b5h9(s) burns vigorously in o2 to give b2o3(s) and h2o(l). what is δh° for the combustion of 1 mol of b5h9(s)? substance δh°f (kj/mol) b2o3(s) –1273

A 10-ounce container of chocolate chips can be used to make 4 desserts. Each dessert has the same number of chocolate chips. Which equation shows how to find