Lwhit11 Lwhit11

11-04-2016
Mathematics

contestada

areil travels 400 miles in 8 hours. what is her rate of change

Respuesta :

Shyla101 Shyla101

11-04-2016

so what u do is divide 400 by 8 and then you will have yuor answer

Answer Link

AmeliaRose AmeliaRose

11-04-2016

Her rate of change would be 50 miles per hour, because that is 400 divided by 8.

Answer Link

Otras preguntas

Self-efficacy is ________.our level of confidence in our own abilitiesthe belief that we have power over our livesa state of being in which our thoughts about o

The stroop effect demonstrates people's inability to ignore the ______ of words.

I need help on exterior angles!

Personal care quiz---when providing nail care it is important to consult a professional true or false

Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.

Mi abuelo no es joven. Es _____

When citizens _______, they help elect people who carry out government tasks. A. vote B. volunteer C. lobby D. nominate

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

With increasing doses of any useful drug there is usually an increase in the number and severity of

Embryological evidence suggests that the echinoderms are closely related to the ______________. arachnids annelids arthropods chordates