smartymarty70 smartymarty70
  • 01-05-2019
  • Mathematics
contestada

what are absolute values of 12​

Respuesta :

gmany
gmany gmany
  • 01-05-2019

Answer:

|12| = 12

Step-by-step explanation:

Definition of absolute value:

|a| = a if a ≥ 0

|a| = -a if a < 0

Examples:

|2| = 2

|-2| = -(-2) = 2

|0.45| = 0.45

|-0.45| = -(-0.45) = 0.45

|1000| = 1000

|-1000| = 1000

Therefore

|12| = 12

Answer Link

Otras preguntas

A 125g steel ball with a kinetic energy of .25j rolls along a horizontal track how high up an inclined track will the ball roll if friction can be ignored
The authors of the Paston letters have which of the following in common with all authors of primary source documents?
To learn more about the genetic material of plant and animal cells, where would a person look? A.in the lysosomes B.in the nucleus C.inside the chloroplasts D.
What is the answer:3(2•4+6÷3)×2+5n-1(67×2)-76+10847n=15
In two to three well-developed sentences, describe the key characteristics of Sol LeWitt's artworks.
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
What were writers, scientists, and thinkers who discussed enlightenment ideas known as
The table shows some ingredients in lasagna. If you make three times the recipe how many cups of cheese are needed. Can you please help me this is my homework f
Identify a reason countries paid tribute
most water vapor in the atmospher is the source of a. couds and rain. b. pollution c. carbon dioxide d. wind.