fanansofia fanansofia
  • 03-08-2019
  • Mathematics
contestada

sinx /1 - cosx + sinx /1 + cosx = 2 cscx

Respuesta :

kosala1478
kosala1478 kosala1478
  • 03-08-2019

Step-by-step explanation:

hi here is ur answer feel free to ask questions

Ver imagen kosala1478
Answer Link

Otras preguntas

On a number line, let point p represent the largest integer value that is less than 407. le point q represent the largest integer value that is less than 68 − .
Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re
Find 8 + 35 + (-76).
What is the scale factor in the dilation? A) 2/5 B) 1/2 C) 2 D) 2 and 1/2
1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m
Where did the majority of people t ravel from who were heading to make a new life out of the west?
Attorney general a. mitchell palmer believed that he needed to protect the american people from
what is the most important factor that holds a gene pool of a species together and prevents speciation?
Select all that apply: according to fisher, the effects of globalization on indigenous peoples include___________.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat