ksweet15 ksweet15
  • 02-11-2019
  • History
contestada

why did jamestown ultimately survive as a permanent settlement

Respuesta :

SomeRandomGuy156
SomeRandomGuy156 SomeRandomGuy156
  • 02-11-2019

Oh boy, time to explain jamestown!

_____________________________________________________

John Smith saved the colony from starvation. He told colonists that they must work in order to eat. John Rolfe had the colony plant and harvest tobacco, which became a cash crop and was sold to Europe.

_____________________________________________________

Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
2ln(5x)=8 solve for x
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
what is the percent change from 70 to 56?
Why did the french revolution happen and who's fault was it
Fossils are most commonly found in which type of rock?
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what rule does static electricity follow