drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

The ratio in lowest terms of length to width for a rectangle with length 10 and width 4 is 5/2 . True False

Which of the following points would fall on the line produced by the point-slope form equation y + 3 = 2(x + 4) when graphed? (-1, 3) (-1, 7) (2, 5) (-2, -1)

I need help what is terrane

Which part of the world did the United States intervene most by sending troops in the nineteenth century?

Identify the question that people should ask themselves when previewing both images and texts. A.What is my first response to this work? B.What clues do I see

Given: F(x) = 3x and G(x) = x 2 + 1 Find (F + G)(x). 3x³ + 1 x² + 3x + 1 3x² + 1

SOME HELP! PLZ! Which words in the sentence make up the prepositional phrase? Yesterday evening two crickets hopped into the garage. A. Yesterday evening B. cr

What is the average speed of an object that moves 100 m in 4 seconds and then remaining at rest for 1 second?

In the figure, a∥b and m∠3 = 34°. What is the m∠7 ? Enter your answer in the box.

In a nonpolar covalent bond, protons are shared equally by two atoms. electrons are shared equally by two atoms. electrons are shared unequally by two atoms. pr