youngpogba6 youngpogba6
  • 03-02-2020
  • Chemistry
contestada

How many moles are in 76.34 grams of Ba(OH)2

Respuesta :

pamelaarambula2 pamelaarambula2
  • 03-02-2020

Answer:

0.44554249730713513

Explanation:

Answer Link
nigelflemming1 nigelflemming1
  • 04-02-2020

Answer:

0.4455424973071 thats ur answer i hope u get it

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How do you find the length of the hypetnyuse if you have one angle and opposite side?
In a standard normal curve, what percentile corresponds to a z-score of 2.0?
Osmosis is how excess salts that accumulate in cells are transferred to the blood stream so they can be removed from the body. explain how this process works in
What did Jimmy Carter base his views on foreign-policy?
Franklin delano roosevelt (january 30, 1882 to april 12, 1945) was the 32nd american president who led the united states through the great depression and world
What is the solution of the system of equations? y = –2x + 8 y = x – 4
When did christianity become the official religion of the roman empire?
I just need a confirmation that my answer is right? Find side AC. Round to the nearest hundredth. The angles are: Angle A = 40°, Angle C = 90°, and Angle B = 50
The_____ form acidic compounds with hydrogen.