cwembolenga8 cwembolenga8
  • 04-02-2020
  • Mathematics
contestada


[tex]13 = w - 14 \div 2[/tex]
​

Respuesta :

fred6810 fred6810
  • 04-02-2020
Your answer is going to be 21 u just subract from the number to get ur answer
Answer Link

Otras preguntas

¿Qué es un PC? a. computadora personal b. campana personal
Which pattern best describes Alzheimer’s disease versus another related dementia? a. A gradual and progressive decline in the abilities of multiple cognitive do
Research indicates that evidence is usually more persuasive when it is stated in specific rather than general terms
Select all that apply. Which of the following measurements have 1 significant figure? 0.007 7000 7000.0 7
please find slope! thanks
1. The square root of 70 is between what two numbers? A) 7 and 8 B) 8 and 9 C) 9 and 10 D) 64 and 81 2. Which of the choices is NOT a good example of a line
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
describe how a company that produce earphones can design a survey
Match the genes with their linkage ability.
who is in charge in a command enonomy