macycubiottioqxgj5 macycubiottioqxgj5

01-04-2020
Mathematics

contestada

Accounting provides information to

A. Managers
B. Government
C. Investors
D. All of the above

Respuesta :

genius422 genius422

01-04-2020

Answer:

Managers

Step-by-step explanation:

Follow me please

Answer Link

LunaS2000 LunaS2000

01-04-2020

Answer:

It can provide information to Employees, Managers, and Auditors.

But in this case your answer would be "All of the above"

Step-by-step explanation:

Answer Link

Otras preguntas

Help! Exponential Equation WITHOUT CALCULATOR

How have terrorism and the 9/11 attacks changed the policies of the United States in regards to immigrants and terrorism? Discuss the events of 9/11 and the War

Is the interaction that occurs among elements of the department of defense engaged us government?

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per

Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.

NEED HELP PLEASE WORTH 15 POINTS Which equation would best help solve the following problem? The height of a triangle is 4 m less than its base. The area of the

Aerial photographs most often are taken from __________. A. aircrafts B. hot air balloons C. satellites D. space shuttles

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

can someone help me please

the influence of Greek and Roman culture on some Renaissance art is reflected in what