jjmanzfap jjmanzfap
  • 02-05-2020
  • Mathematics
contestada

13-0.5w+6x when w=10 and x =1/2

Respuesta :

mysticchacha
mysticchacha mysticchacha
  • 02-05-2020

Answer:

53

Step-by-step explanation:

5w+6x when w=10 and x =1/2

I suppose you want to evaluate this expression for the given values of the variables.

5w + 6x = 5*10 + 6*(1/2) = 50 + 3 = 53

Answer Link

Otras preguntas

Suppose that the central bank must follow a rule that requires it to increase the money supply when the price level falls and decrease the money supply when the
Write one sentence explaining common goals of nineteenth-century women and African Americans who were pursuing reform.
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?
Dominos Pizza for years made a claim that they would deliver your pizza within 30 minutes ("30 minutes or less") of your order being placed (provided you live w
1.Is 435 evenly divisible by 5?Circle: Yes or No​
Which statement best states how the author conveys her purpose for writing the article? A The author presents her opinions on why biometric technology is helpfu
Which of the following statements is NOT true?
which of the following describes a major factor in the conflict that the United States had with the Soviet union during the cold war
How did "hawks" feel about and how did "doves" feel about the war?
pls I need help i will give brainliest answer Mg + __HCl  → MgCl2 + H2 What coefficient is needed to balance the equation? A.6 B.2 C.1 D.3