leggish
leggish leggish
  • 13-05-2020
  • Mathematics
contestada

How to find the area of a cylinder :(

Respuesta :

briannaigor23 briannaigor23
  • 13-05-2020

Answer:

A   =   2 π r h   +   2 π r 2

Step-by-step explanation:

Always remember if your having trouble look back on the formula. :D

Answer Link
macybaltzley
macybaltzley macybaltzley
  • 13-05-2020

Answer:

A=2πrh+2πr^2.

Answer Link

Otras preguntas

The length of a rectangular garden is 555 meters long. The area of the garden is 101010 square meters. P.S NEED HELP
The Supreme Court's ruling in Plessy v. Ferguson was problematic because?
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT
Which accomplishment could be added to this diagram?
The molar mass of element X is 42.3 grams per mol and the molar mass for element Y is Y 96.7 grams per mol. What is the empirical formula for a substance contai
What is 10z when z = 0.8 Plssss help mee
what is chemical weathering? what are some facts? ​
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT
Use the graph to write a linear function that relates y to x Y=
How does looking at the ocean make Ralph feel? Why? Lord of the flies chapter 7 I need need helllppp