Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

What are two ways that setting contributes to a story? It highlights the themes. It influences characters’ actions. It creates a particular mood. It establishes

como me duele? Como me duele? Como me duele que____

Help this is due in 10 minutes please help

5x−4=16 what do i do

Even though both can help you save money, there are differences between the two. Answer the following question to see how well you understand the difference bet

study the image wich shows an air mass moving into a region wich type of weather will this region most likely experience due to the incoming air mass

Please help me!! Will give brainlyist

Find the slope of the line from a graph! Will Give brainliest :)

What is one benefit US workers who have a college degree rather than a high school diploma?

How is acceleration different from velocity? Acceleration is a change in velocity by either accelerating, decelerating or changing direction Acceleration is onl