OverlordOfDarkness OverlordOfDarkness

15-05-2020
Social Studies

contestada

Would Mexico have viewed a Mexican advance north of the Rio Grande as an invasion of the US?

Respuesta :

stuautumnpayton stuautumnpayton

15-05-2020

Yes, because they didn't know what was really happening over there they tried to stay out of it they sent people over and heard terrible things US was doing to they.

Answer Link

Otras preguntas

A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the

Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

What is the range of function of y-1=(x+3)^2

if a star is shown ti be 33.11 trillion killometers away , how many light year would that be

A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?

What is the primary purpose of the Supremacy Clause?

On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?

accurate estimation 719-348

Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa