stefanierayliene stefanierayliene
  • 01-07-2020
  • Biology
contestada

Which process directly moves nutrients from plants to animals

Respuesta :

jghazi25 jghazi25
  • 01-07-2020

Answer:

consumption process does

Answer Link
martinezfrederick76
martinezfrederick76 martinezfrederick76
  • 01-07-2020

Answer:

consumption does

Explanation:

I looked for it :)

Answer Link

Otras preguntas

what is a molecule that plays a role in a feedback loop?
Filling and Emptying Tanks 1) Tank B, which initially contained 80 liters of water, is being drained at a rate of 2.5 liters per minute. How many liters of wate
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
Kelsey has an orange ribbon and a blue ribbon. The orange ribbon is 7 11/12 inches long and the blue ribbon is 17 5/12 inches long. How much longer is the blue
Which field is not used for non inventory products
-u + 136 = 182 solve for u
For the given function, find (a) f(1) (b) f(-2). (a) f(1) = (b) f(-2) =
What is the slope of the line passing through (-2, 4) and (3, -4)?
What is the full meaning of COPOOL​
Find the gradient of the tangent to the circle at point (3,9)