royaltythreats1 royaltythreats1
  • 11-08-2020
  • Business
contestada

Why isn’t Brainly working?

Respuesta :

pjk8822
pjk8822 pjk8822
  • 11-08-2020

Answer:

Same! I look up a question and it says seems like there's a connection issue.

Explanation:

Only way to get questions is look them up on Google and they pop up on there website. hope they fix it soon

Answer Link

Otras preguntas

please help me i’ll mark you as brainlist
the soil near the river delta is very fertile. which of the following words would you use to describe the soil
Which of the following would provide a counterexample to the claim that all swans are white? red swan white blackbird
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
What government response was prompted by Nat Turner's Rebellion? Jim Crow laws were enacted. Slave codes were made more restrictive. The Virginia Resolution was
-2x – (-6x) + 4 = 3x – (-2) +1-(-3) Sole the equation
3(k+9)=8-(-3k-19) solution types a. no solutionb. infinitely many solutions ?​
Marc mixes blue and yellow paint to make his favorite shade of green, which he'll use to paint his house. He has 14 cans of blue paint and 20 cans of yellow pai
Jorge bought a phone card that has 120 min of phone use on it. The first week, he used 37.7 min. The second week, he used 12.7 min. The third and fourth weeks,
How much is the interest on my loan? I = Prt I = 400 x 0.08 x 2 Interest $ .00 PLEASE ANSWER ASAP