jjtechnoyt jjtechnoyt

02-10-2020
Mathematics

contestada

What is the 7th term of the geometric sequence?

2, 8, 32, 128, ...

Respuesta :

ramseyjemore ramseyjemore

02-10-2020

The 7th term of the geometric sequence is 8,192!

Answer Link

Otras preguntas

what was one way the french bourgeoisie came to adapt the ideals of thre enlightment

Two numbers are called relatively prime if their greatest common divisor is $1$. Grogg's favorite number is $10!$, the product of the integers from $1$ to $10$.

What should I include in a conclusion about the roman empire's social economic and political aspects? I wrote about how Christianity affected it, how inflation

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Three horse share five bales of hay equally. Five cows share eight bales of hay equally. How much hay does each horse and each cow get? Which animal gets more,

25 Which wavefront is travelling at a speed closest to that of a sound wave through a solid? A one that moves 10m in 0.01 s B one that moves 50m in 0.5s C one t

How were the causes of european/asian imperialism similar to the u.s

James and Lucas are eating a pizza. James ate 2/3 of the pizza and Lucas ate 1⁄4 of pizza. Who ate more pizza and by how much?

Why is using a car not a good reason to use as a reference point

Which of the following statements best describes a survey question? A question you will ask the people in your sample. A question designed to collect a single d