Niababyonfleek2 Niababyonfleek2

02-10-2020
Mathematics

contestada

Can somebody please help with this ?? :)

Order the following weights from smallest to largest 17,000 mcg, 12 mg, 10 gr, 0.4 g, 1.oz, 1/2 lb.

Respuesta :

alex815 alex815

02-10-2020

Answer:

1/2 pound

1 ounce

17,000 mcg

10grams

0.4

12 mg

Answer Link

Otras preguntas

Brainly who were the big three? the leaders of france, great britain, and italy the leaders of the soviet union, great britain, and the united states the leader

what is the inverse of f if f(x)=^3 sqrt x-4

Zhi bought 18 tickets for games at a fair. Each game requires 3 tickets. Zhi wrote the expression 18 – 3g to find the number of tickets she has left after playi

A women-only gym has 60% of its members married. 75% of the married women exercise in the morning and 30% of the single women exercise in the morning. Are being

For the year 2008, the fao estimated that every person on the planet consumed at least _____ percent of their animal protein intake as fish.

The probability of Mrs. Galvan randomly selecting a black pen from the 20 pens in her drawer is . Which of the following describes the likelihood of selecting a

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

O relieve dissonance, people will try to change _______, so that attitudes, beliefs, and behavior will once again support one another. the subject their cogniti

What is the net ionic equation for ZnSO4 ?

Sunrise trail 3 1/4 miles. The sign shows the length of a trail in a park. What is the length, in feet of the trail?