Alexapozos Alexapozos
  • 12-10-2020
  • Mathematics
contestada

What is 16 divided by -8

Respuesta :

jumptime556 jumptime556
  • 12-10-2020
The answer is -2 you welcome
Answer Link

Otras preguntas

Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
testosterone directly affects the
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
Why was wilson not able to finish his speaking tour
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Give a recursive algorithm for finding the sum of the first n odd positive integers.
the perimeter of a square 116ft ?