sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

You suspect that a sample of rock dates from about 200,000 years ago. If you want to determine an absolute date for this rock, which dating method would you use

Which equation is y = 9x2 + 9x – 1 rewritten in vertex form?

Was hitlers birthday 4/20

Which of the following is not a mineral resource found in Central America? a. bauxite c. copper b. nickel d. gold

Calculate the force between charges of 5.0 x 10^-8 c and 1.0 x 10^-7 if they are 5.0 feet apart

The sun is the primary source

What is 25 x 10^6 I need to know fast

From where do the Israelites trace their beginnings?

When a star dies, which of these celestial objects is it most likely to help create? A. a planet B. a star C. a moon D. a meteor E. a comet

Please Help , Is it Abc or D