i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

plz hurry Which lines contain assonance? A. How do I love thee? Let me count the ways B. I love thee freely, as men might strive for night C. My soul can reach,

Find the 15th term of the geometric sequence 3, -6, 12, ...

The assumptions of the production order quantity model are met in a situation where annual demand is 3650 units, setup cost is $50, holding cost is $12 per unit

You are studying nuclear lamins and use recombinant DNA technology to alter the coding sequence of a nuclear lamin gene. The alteration you make creates a situa

6 statistical facts about 1st, 2nd, and 3rd degree burns. (Has numbers not just words)

Imagine that you work for the local animal shelter. Your goal is to increase the number of people who are willing to adopt a dog from the shelter. According to

The monthly budget for the front of the house is $5,000. You spent 10% of the budget on fresh flowers. How much did you spend on fresh flowers?

eanyone know??? get it correct u get 50 points

The outstretched hands and arms of a figure skater preparing for a spin can be considered a slender rod pivoting about an axis through its center. When his hand

Write a class definition of a class named Value with the following: a boolean instance variable named modified, initialized to false an int instance variable na