user202058 user202058
  • 01-11-2020
  • Biology
contestada

Please help I would really appreciate it

Please help I would really appreciate it class=

Respuesta :

mitak5575
mitak5575 mitak5575
  • 01-11-2020

Answer: the answer is cell wall

Explanation:The cell wall is an outer protective membrane in many cells including plants, fungi, algae, and bacteria. Animal cells do not have a cell wall. The main functions of the cell wall are to provide structure, support, and protection for the cell

Answer Link

Otras preguntas

What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Please help me with this two step math problem! THANK YOU !!!!!!!!
the reproductive system of a male mammal provides
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Is 5/7 greater than 4/6