xRatsxRatsxRatsx xRatsxRatsxRatsx

03-10-2016
Mathematics

contestada

oranges each
$0.38

Apples each
$0.26

number 21

oranges each038 Apples each026number 21 class=

Respuesta :

Аноним Аноним

03-10-2016

I would say just add them together

Answer Link

Otras preguntas

The overall purpose of continuing the Civil War to address the issue of slavery rested on a document written by President Lincoln called the _____.

The squirrel who ran in circles around the circumference of the tree chattered angrily at the curious cat. Which correctly revises the sentence?

what two things does Nick see on/ near the queensboro bridge that make him think that Gatsby is perhaps telling the truth

Which term best describes a situation in which the state is governed by a set of rules, rather than by a group of individuals?

A nurse is working with a client diagnosed with somatization disorder. what criteria would differentiate this diagnosis from a somatoform pain disorder?

The election of Andrew Jackson is often considered the beginning of which modern political party?

The industrial revolution involved basic changes

how is the supreme court equal to the other branches of government?

Who was a famous Cuban landscape painter during the Industrial Revolution? A. Amelia Peláez B. Leopoldo Romañach C. Nelson Dominguez

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the