boodawatson58 boodawatson58

12-11-2020
Mathematics

contestada

Choose the solutions to the quadratic equation
x2 - 8x - 9 = 0.
-21
ex? - 8x = 9 to
-1
9
29
DONE

Respuesta :

sanamjanm30 sanamjanm30

12-11-2020

29 I think but iam not sure if it’s right

Answer Link

Otras preguntas

The first digit of the unlock code is 6 greater than the second digit. It is also 3 times greater than the second digit . The third digit is four less than the

Khandi has an important oral presentation coming up. She wants to be sure that she gives the best presentation she can give. What is the best way for her to get

A firm derives revenue from two sources: goods X and Y. Annual revenues from good X and Y are $10,000 and $20,000, respectively. If the price elasticity of dem

SiCl4(l) + H2O(l) → SiO2(s) + HCl(aq)

Pure magnesium metal is often found as ribbons and can easily burn in the presence of oxygen. When 3.97 g of magnesium ribbon burns with 8.05 g of oxygen, a bri

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Find measure of angle 2

According to the American Psychological Association, what is the most significant source of stress for Americans? (2 points) Health Money Education Work

If the ordered pair (x, y) is the solution for the system of equations, what is the value of y? x + y = 29 x + 2y = 12

When did World War II begin in Europe?