12-10-2016
Mathematics

contestada

50=15-6(2x-5) I need the work shown please

Respuesta :

Аноним Аноним

12-10-2016

I hope this helps you

6 (2x-5)=50-15

6.2x-6.5=35

12x=35+30

12x=65

x=5,41666

Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

What number gives a result of −3 when 7 is subtracted from the quotient of the number and 5?

A bag with 8 marbles has 4 yellow marbles and 4 blue marbles. A marble is chosen from the bag at random. What is the probability that it is red?

metals are the best materials for making shoes. what do you think?

Drake's sister Stephanie is 2 years younger than him. If the sum of Drake's age and 2 times Stephanie's age is 98, how old is Stephanie?

Please help i will mark brainliest

A simple bread recipe calls for 400 g of flour, 7 g of salt (NaCl), 1 g of yeast, and 0.3 L of water (H2O). You have exactly 0.6 mol of salt. If you want to us

Does the following infinite series converge or diverge? 1/3+2/9+4/27+8/81

3rd attempt I need 7-25 and 7-26 please and thank you.

Work out : 2 7_ ÷ _7 8