mohammadjhabib17 mohammadjhabib17
  • 02-12-2020
  • Mathematics
contestada

what is the y- intercept of the line 5x + 2y= 10?

Respuesta :

simon22811
simon22811 simon22811
  • 02-12-2020

Answer:

5

Step-by-step explanation:

5x + 2y = 10

2y = 10 - 5x

y = -5/2x + 5

Answer Link

Otras preguntas

my teacher ask me whats 2+2 and i said its not 30 ​
Can someone help lol
Which philosopher(s) likely influenced the following statement from the Declaration of Independence? "We hold these truths to be self-evident, that all men are
Colonialism in Rwanda how was Colonialism in South Africa different ?
PLZ HELP solve plzs 560*921
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
Hey, can anyone solve this real quick? (It's pretty easy but my brain has melted today.)
Solve for X Find the length of the missing side (Picture)
round 8643 to the nearest hundred
Define the life lessons from the novel ‘The Adventures of Tom Sawyer' and support your answer with the examples of struggles the teenagers have to face nowadays