cheyyy5 cheyyy5

14-01-2021
Biology

contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya angelomontoya

14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

Your class raises money for a trip to the water park. You make $74 from fruit bar sales and $250 from gift card sales. How much money do you raise?

What is the slope of the line that is perpendicular to the line whose equation is 2x + y = 4. -2 - 2

One advantage of a pressurized water reactor is the separation of water that is near radioactive material and the water that is converted into steam true or fal

Explain one possible object of employees within a business

How are prokaryotic cells and eukaryotic cells different?

Help on this pleasee

Identify the metaphor below

Some of the offspring of two gray bodied flies are black. what can you conclude about the genotypes of the parent flies?

Please select the word from the list that best fits the definition : Rome's greatest public speaker

please help! 10 points, thank you :)