FhozyOk FhozyOk
  • 15-01-2021
  • English
contestada

So I need help with my ELA pls help someone

So I need help with my ELA pls help someone class=

Respuesta :

kaleaandjack
kaleaandjack kaleaandjack
  • 15-01-2021

Answer:

this is a little hard to see.

Explanation:

Answer Link

Otras preguntas

why did christopher columbus fail to find new trade routes
A flashlight beam strikes the surface of a pane of glass ( n = 1.58) at a 46 ∘ angle to the normal. What is the angle of refraction?
can this diary teach us anything about slang used during wwii
If you need to set up direct deposit, which information from your check would you likely need? acheck number bmemo line cnumerical amount drouting number
In a function, y varies directly with x, and the constant of variation is 2. Which table could represent this function?
How did the Soviet press and government handle the liberation of the death camps?
Which function represents the exponential function f(x)=3x after a vertical stretch by a factor of 8 and a reflection across the x-axis? A) g(x) =3-8xB) g(x) =-
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
During the earliest stages of the universe, the only things that existed were A) the Sun and the planets. B) helium and hydrogen. C) clumps and gravity. D) s
If the arc length of a sector in the unit circle is 3 radians, what is the measure of the angle of the sector?