liyahparker22
liyahparker22 liyahparker22
  • 02-11-2016
  • Mathematics
contestada

Solve this system of equations.

x + y = -3

x - y = 1

Respuesta :

GraceTheFace
GraceTheFace GraceTheFace
  • 02-11-2016
a. (-1,-2)

Because:
x + y = -3                                     
-1 + (-2) = -3
-3 = -3

x - y = 1
-1 - (-2) = 1
-1 + 2 = 1
1 = 1
Answer Link
Аноним Аноним
  • 02-11-2016
the correct answer is A.
Answer Link

Otras preguntas

what are two ways to change particle movement
Ud. ________ (cortar) la carne
Soil erosion is mainly due to which of the following reasons? wave action earthquakes heavy rainfall deforestation
which response best completes this conversation? Samuel Delgado: ¿Como le va? Profesora Gonzalez
What factor contributed to the fall of the Songhai empire
According to the distributive property, a(5 + b) = A) 5a + b B) 5a + ab C) a (b + 5) D) 5 (a + b) What is the correct answer above?
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
In one week the mass of a puppy is 1.8kg and the next week it's 2.25kg. Work out the percentage increase.
What is the answer and formula for 7f+5=68
12 = x - (-9) What is the variable x