Seudónimo Seudónimo
  • 11-02-2021
  • Spanish
contestada

como se dice "storm" en español

Respuesta :

Аноним Аноним
  • 11-02-2021

Answer:

Tormenta

Explanation:

Answer Link
cchi0255 cchi0255
  • 11-02-2021
storm is “tormenta”
Answer Link

Otras preguntas

Which of fowler's stages of faith is most parallel to the level of belongingness and love needs in maslow's theory? universalizing synthetic-conventional conjun
A box has a base of 12 inches by 12 inches and a height of 30 inches. What is the length of the interior diagonal of the box? Round to the nearest hundredth
Help please !!!! Giving brainliest
Suppose the diameter of a circle is \color{green}{10}10 start color green, 10, end color green. what is its radius
Amber's bank statement shows a closing balance of $224.13. There are no outstanding checks deposits. Her checkbook shows a balance of $221.38. What might accoun
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
What causes ocean water near the equator to be warmer than ocean water farther north
ad is tangent to circle o at d. find ab. round to the nearest tenth if necessary
Explain how globalization has affected the United States from the 1970s on. Do you believe that globalization has been positive for the US? Why or why not?
Severe edema in pregnant women may be a symptom of what health condition?