heidihamilton06 heidihamilton06

01-03-2021
Mathematics

contestada

what is each measure of the rhombus?

what is each measure of the rhombus class=

Respuesta :

mackenziesmith72006 mackenziesmith72006

01-03-2021

a. 15
b. 26

d. 41
e. 82
f. 98

h. 49

Answer Link

Otras preguntas

help with C please and don't lie I will know if your answer is wrong

The back of Toms property is a creek. Tom would like to enclose a rectangular area, using the creek as one side and fencing for the other three sides, to create

In the following chemical wording, which atom gains electrons?(The formula is in the picture)The answers to choose are:•none•aluminum•oxygen•iron

the gfc of 24 and 64

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

EspanolA rectangular yard measuring 29 ft by 50 ft is bordered (and surrounded) by a fence. Inside, a walk that is 3 ft wide goes all the way along the fence. F

What are the domain and range of this relation? у 5 2 1 X -4 -3 -2 -1 0 1 2 4 5

Find the absolute change and the relative change in the following cases.The number of refugees in the world increased from 8.7 million in 2005 to 16.1 million i

3) Given the points (6-11) and (-2,9), find the following: a) find the slope between these points, b) find the equation of the line between these points, b) fin

Question #2A wrestler wants to gain weight to participate in a tournament within a specific weight class. Thewrestler starts a nutrition plan and weighs in at t