RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult

14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

Find the value x2 when x = 5

a ship leaves a dock moving at 24 mi/h. Three hours later, a second ship sets out from the same dock ta 32 mi/h. How long will it take for the second ship to ov

Lin wrote a report about her family. She wrote that her great grandmother was born in November of 1897 and got married at the age of 23 in January of 1920. What

A garden table and a bench cost $889 combined. The garden table costs $61 less than the bench. What is the cost of the bench?

Seidner Company has the following information available: Total fixed costs $80,000 Targeted after-tax net income $18,000 Contribution margin per unit $2.00 Tax

Please Please Please Please Please I’ll Give Brainlywst

please help for this assignment you will write a political speech/essay

I'm French, I did the exercise but I don't know if it's right Use the comparative forms and at least three of the adjectives below : easy / difficult / modern

An interpretation based upon an observation is called.

Find the value of x when 6 - 3x = 5x - 10x + 18. The value of x is x