emzogwayo emzogwayo

03-05-2021
Biology

contestada

Give any 3 parts of a microscope that could make a student see a blurred image.

Respuesta :

starcherarielle24 starcherarielle24

03-05-2021

Answer:

Contrast can be altered by light intensity and staining. How do the coarse and fine focus knobs work on a bright field microscope?

Explanation:

Answer Link

Otras preguntas

There are 36 muffins in the bakery if 2/9of the muffins or cinnamon how many muffins or cinnamon, my daughter is asking!!!

Incidents of Basque violence are caused by their desire for _____??? A. educational opportunities B. improved health care C. increased wages D. increased wages

The Taj Mahal was built with influences from which two cultures? A. Islamic and Byzantine B. Hindu and Mughal C. Byzantine and Hindu D. Islamic and Hindu

complete the sentence. 800 is 10 times as much as

order fractions 3/10,3/6,2/5?

after reading the cask of amontillado by Edgar allan poe write an argumentative essay in which you make a claim the narrator of the story. in Montresor sane or

the diagram shows a sliced pizza . the largest slice shown is what fraction of the pizza . a ( 1/2b ( 1/4c ( 1/5d ( 1/8

how have the Russians responded to pollution and environmental challenges

0.506 rounded to the nearest tenth

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3