Chr2istmnbori Chr2istmnbori

12-12-2016
Chemistry

contestada

A mixture of methane and air is used in a lime kiln. Explain why?

Respuesta :

johnkellock johnkellock

14-12-2016

As the methane combusts with the oxygen in the air. Methane is also known as natural gas.

Answer Link

Otras preguntas

From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.

Which quotation from the text best supports the inference that the people of the sac nation do not typically challenge authority? "if he declared war he must le

Which are True or False ?

What physical properties must the substances in a mixture have to use filtration to seperate the substances?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she

You develop an app to help students complete their homework. To earn money, you sell advertising space on the app’s main screen. An advertiser pays you $25 per

which goal stated in the preamble to the u.s. constitution requires a strong army

Read each verbal expression Then assign a variable and distribute

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side