Eheheheh7 Eheheheh7

14-01-2022
Mathematics

contestada

Help please and thanks! I'll award brainliest as well :)

Help please and thanks Ill award brainliest as well class=

Respuesta :

14-01-2022

120 that’s right 120 degrees angle

Answer Link

Otras preguntas

Which of the following lists the levels of the federal system in the correct order, starting with the top level of government and ending with the bottom level?

Question 4 2 pts Find the median number of points scored per player by North Carolina. North Carolina: Johnson (14), Meeks (4). Jackson (9). Paige (21), Berry

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

This graph represents a linear relationship between x and y. Which equation best represents the relationship shown in this graph? y=35x y=−53x y=53x y=−35x

In an inequality between two numbers, -2.1 is located below the other number on a vertical number line. So, the other number is -2.1. One possible value of the

if f(x)=10x+3 whar is the value when f(x)=19

Desertification is cause by___ A) temperature variations B) solar heating patterns C) leaching of the soil D) human activity

$59.99 DVD box set, 6.5% tax

17. Las magnitudes de valor en que se intercambian los productos del trabajo cambian constantemente, independiente de los actos de los sujetos del intercambio,

4 points After speaking with Sterling, why does Griffin decide to go to Mississippi?