25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

i want friends , if u r up....

A biologist has 6 quarts of an 18% solution of salt. He adds x quarts of water to reduce it to an 8% solution of salt. Which equation correctly describes the si

AQA 8300-3H GCSE MATHEMATICS Higher Tier Paper 3 Calculator MS June 2022 written by

(1) Jane hasn't been studying as hard as she should this semester. (2) She's been spending all her time playing soccer. (3) Tom, on the other hand, has been sta

If $100 is borrowed and the interest after 6 months is $8, what is the annual interest rate for a simple interest loan?

Which of the following neighborhood facilities is most likely to improve residents' physical fitness?

what is 4 divided by 3.48pls help

Cost for assembling a smart phone is given in formula C(q) = 500 - 2q. Where C is cost, and q is cost for parts. If cost for parts equal $75, find total cost to

Canada computer charges 18.70/h plus 20.00 for a service call. the repairs person came to do maintenance on all of the school's computers. if the job took three

There is a line whose y-intercept is -2 and whose slope is 1. What is its equation in slope-intercept form?