HoneyJiiva
HoneyJiiva HoneyJiiva
  • 12-02-2022
  • Mathematics
contestada

Find the value of each missing variable

Find the value of each missing variable class=

Respuesta :

himkalabhusal8
himkalabhusal8 himkalabhusal8
  • 12-02-2022

Answer:

x=90

y=78

z=70

Now

or,90+78+70

or,238 answer.

Answer Link

Otras preguntas

he variable z is directly proportional to x, and inversely proportional to y. When x is 7 and y is 7, z has the value 2. What is the value of z when x=10, and y
A spinning ice skater will slow down if she extends her arms away from her body. Which of the following statements explains this phenomenon?
Choose the answer that best completes the sentence. Leo __________ en el periódico
-1.2x + 11.45 = 8.21
*PLEASE HELP ASAP* (Will give brainliest) What protects First Nations people rights and freedoms today?
Find the coordinates of the points of intersection of the graphs without building them: 5x–4y=16 and x–2y=6
Are women's feet getting bigger? retailers in the last 20 years have had to increase their stock of larger sizes. wal-mart stores, inc., and payless shoesource,
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
veterinary doctors marked 50 deer and released them. later on they counted 200 deer, 22 where marked. to the nearest whole number, what is the best estimate
Explain two ways wartime mobilization impacted the domestic lives of citizens in the United States during World War II.